|
ATCC
hb 8065 ampk dko mefs x jiang lab n a oligonucleotides primer Hb 8065 Ampk Dko Mefs X Jiang Lab N A Oligonucleotides Primer, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/hb 8065 ampk dko mefs x jiang lab n a oligonucleotides primer/product/ATCC Average 99 stars, based on 1 article reviews
hb 8065 ampk dko mefs x jiang lab n a oligonucleotides primer - by Bioz Stars,
2026-05
99/100 stars
|
Buy from Supplier |
|
TaKaRa
3 forward primer 3 5 reverse primer mir 146a 5p mi0000477 mirbase tgagaactgaattccatgggtt takara bio cat 3 Forward Primer 3 5 Reverse Primer Mir 146a 5p Mi0000477 Mirbase Tgagaactgaattccatgggtt Takara Bio Cat, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/3 forward primer 3 5 reverse primer mir 146a 5p mi0000477 mirbase tgagaactgaattccatgggtt takara bio cat/product/TaKaRa Average 97 stars, based on 1 article reviews
3 forward primer 3 5 reverse primer mir 146a 5p mi0000477 mirbase tgagaactgaattccatgggtt takara bio cat - by Bioz Stars,
2026-05
97/100 stars
|
Buy from Supplier |
|
Qiagen
primers 249900 Primers 249900, supplied by Qiagen, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primers 249900/product/Qiagen Average 97 stars, based on 1 article reviews
primers 249900 - by Bioz Stars,
2026-05
97/100 stars
|
Buy from Supplier |
|
Illumina Inc
ts primer-x Ts Primer X, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/ts primer-x/product/Illumina Inc Average 90 stars, based on 1 article reviews
ts primer-x - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
Qiagen
pre prepared primer assay Pre Prepared Primer Assay, supplied by Qiagen, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/pre prepared primer assay/product/Qiagen Average 96 stars, based on 1 article reviews
pre prepared primer assay - by Bioz Stars,
2026-05
96/100 stars
|
Buy from Supplier |
|
Premier Biosoft
primer premier 5.0 x software Primer Premier 5.0 X Software, supplied by Premier Biosoft, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/primer premier 5.0 x software/product/Premier Biosoft Average 90 stars, based on 1 article reviews
primer premier 5.0 x software - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
Thermo Fisher
x sbe primers X Sbe Primers, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/x sbe primers/product/Thermo Fisher Average 99 stars, based on 1 article reviews
x sbe primers - by Bioz Stars,
2026-05
99/100 stars
|
Buy from Supplier |
|
TaKaRa
mrq 3 primers Mrq 3 Primers, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/mrq 3 primers/product/TaKaRa Average 97 stars, based on 1 article reviews
mrq 3 primers - by Bioz Stars,
2026-05
97/100 stars
|
Buy from Supplier |
|
Yeasen Biotechnology
phusion high-fidelity dna polymerase, universal pcr primers and index (x) primer Phusion High Fidelity Dna Polymerase, Universal Pcr Primers And Index (X) Primer, supplied by Yeasen Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/phusion high-fidelity dna polymerase, universal pcr primers and index (x) primer/product/Yeasen Biotechnology Average 90 stars, based on 1 article reviews
phusion high-fidelity dna polymerase, universal pcr primers and index (x) primer - by Bioz Stars,
2026-05
90/100 stars
|
Buy from Supplier |
|
Qiagen
quantities primer assay Quantities Primer Assay, supplied by Qiagen, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/quantities primer assay/product/Qiagen Average 96 stars, based on 1 article reviews
quantities primer assay - by Bioz Stars,
2026-05
96/100 stars
|
Buy from Supplier |