Review





Similar Products

99
ATCC hb 8065 ampk dko mefs x jiang lab n a oligonucleotides primer
Hb 8065 Ampk Dko Mefs X Jiang Lab N A Oligonucleotides Primer, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/hb 8065 ampk dko mefs x jiang lab n a oligonucleotides primer/product/ATCC
Average 99 stars, based on 1 article reviews
hb 8065 ampk dko mefs x jiang lab n a oligonucleotides primer - by Bioz Stars, 2026-05
99/100 stars
  Buy from Supplier

97
TaKaRa 3 forward primer 3 5 reverse primer mir 146a 5p mi0000477 mirbase tgagaactgaattccatgggtt takara bio cat
3 Forward Primer 3 5 Reverse Primer Mir 146a 5p Mi0000477 Mirbase Tgagaactgaattccatgggtt Takara Bio Cat, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/3 forward primer 3 5 reverse primer mir 146a 5p mi0000477 mirbase tgagaactgaattccatgggtt takara bio cat/product/TaKaRa
Average 97 stars, based on 1 article reviews
3 forward primer 3 5 reverse primer mir 146a 5p mi0000477 mirbase tgagaactgaattccatgggtt takara bio cat - by Bioz Stars, 2026-05
97/100 stars
  Buy from Supplier

97
Qiagen primers 249900
Primers 249900, supplied by Qiagen, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primers 249900/product/Qiagen
Average 97 stars, based on 1 article reviews
primers 249900 - by Bioz Stars, 2026-05
97/100 stars
  Buy from Supplier

90
Illumina Inc ts primer-x
Ts Primer X, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ts primer-x/product/Illumina Inc
Average 90 stars, based on 1 article reviews
ts primer-x - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

96
Qiagen pre prepared primer assay
Pre Prepared Primer Assay, supplied by Qiagen, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pre prepared primer assay/product/Qiagen
Average 96 stars, based on 1 article reviews
pre prepared primer assay - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

90
Premier Biosoft primer premier 5.0 x software
Primer Premier 5.0 X Software, supplied by Premier Biosoft, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/primer premier 5.0 x software/product/Premier Biosoft
Average 90 stars, based on 1 article reviews
primer premier 5.0 x software - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

99
Thermo Fisher x sbe primers
X Sbe Primers, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/x sbe primers/product/Thermo Fisher
Average 99 stars, based on 1 article reviews
x sbe primers - by Bioz Stars, 2026-05
99/100 stars
  Buy from Supplier

97
TaKaRa mrq 3 primers
Mrq 3 Primers, supplied by TaKaRa, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mrq 3 primers/product/TaKaRa
Average 97 stars, based on 1 article reviews
mrq 3 primers - by Bioz Stars, 2026-05
97/100 stars
  Buy from Supplier

90
Yeasen Biotechnology phusion high-fidelity dna polymerase, universal pcr primers and index (x) primer
Phusion High Fidelity Dna Polymerase, Universal Pcr Primers And Index (X) Primer, supplied by Yeasen Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/phusion high-fidelity dna polymerase, universal pcr primers and index (x) primer/product/Yeasen Biotechnology
Average 90 stars, based on 1 article reviews
phusion high-fidelity dna polymerase, universal pcr primers and index (x) primer - by Bioz Stars, 2026-05
90/100 stars
  Buy from Supplier

96
Qiagen quantities primer assay
Quantities Primer Assay, supplied by Qiagen, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/quantities primer assay/product/Qiagen
Average 96 stars, based on 1 article reviews
quantities primer assay - by Bioz Stars, 2026-05
96/100 stars
  Buy from Supplier

Image Search Results